Appendixes

1. Surveillance Plan of Corona Virus Disease 2019 Cases

(Fourth Edition)

2. Epidemiological Investigation Plan of Corona Virus Disease 2019 Cases

(Fourth Edition)

3. Management Plan for Close Contacts of Corona Virus Disease 2019 Cases

(Fourth Edition)

4. Technical Guidelines for Laboratory Examination of Corona Virus Disease 2019

(Fourth Edition)

5. Individual Protection Guidelines for Specific Populations

(Second Edition)

6. Technical Plan for Disinfection in Specific Places

(Second Edition)

Appendix 1 Surveillance Plan of Corona Virus Disease 2019 Cases

(Fourth Edition)

Cases of COVID-19 have been found in Wuhan, Hubei Province since December 2019. This Plan is formulated to give guidance on detecting and reporting cases of COVID-19 timely, ensure early detection and early reporting, and prevent epidemic spread nationally.

1 Aims

1.1 To detect and report COVID-19 cases, 2019-nCoV infected cases, and cluster outbreak cases timely;

1.2 To know the epidemic characteristics of COVID-19, and to judge and predict its developing trend in time.

2 Definition of Surveillance

2.1 Provinces except Hubei

2.1.1 Suspected Cases

The suspected cases should be diagnosed comprehensively through the combination of the following epidemiological exposure history and clinical manifestations:

(1)Epidemiology

1)Having a history of travel or residence in Wuhan and its surrounding areas, or other communities with case reports within 14 days before the disease onset;

2)Having a contact history with patients(a positive result of nucleic acid test of 2019-nCoV)within 14 days before the disease onset;

3)Having a contact history with patients with fever or respiratory symptoms from Wuhan and its surrounding areas, or the communities with case reports within 14 days before the disease onset;

4)Clustering occurrence.

(2)Clinical Manifestations

1)Fever and/or respiratory symptoms;

2)Having the imaging features of pneumonia;

3)In the early stage, a normal or decrease of total white blood cells count and a decrease of lymphocytes count can be found.

Patients who satisfy any one of the epidemiological exposure histories as well as any two of the clinical manifestations can be diagnosed as suspected cases. Patients with no definite epidemiological history can be diagnosed only if meeting the above three clinical manifestations.

2.1.2 Confirmed Cases

The suspected cases with one of the following etiological evidences can be diagnosed as confirmed cases:

(1)A positive result of the nucleic acid of 2019-nCoV by real-time fluorescence RT-PCR in respiratory tract specimens or blood specimens;

(2)The virus gene sequence of respiratory tract specimens or blood specimens is highly homologous to the known 2019-nCoV.

2.1.3 Asymptomatic Carriers

Asymptomatic carriers who present with no clinical symptom but with a positive result of the pathogens tests of 2019-nCoV in respiratory tract specimens and so on, found mainly through the investigation of cluster outbreak and tracking of source of infection.

2.1.4 Cluster Outbreak

A cluster outbreak means that more than two confirmed cases or asymptomatic carriers are found within 14 days in a small area(such as a family, a building site, a work unit, etc.), and there is a possibility of humanto-human transmission caused by close contact or by exposure to infectious source together.

2.2 Hubei Province

2.2.1 Suspected cases

The suspected cases should be diagnosed comprehensively through the combination of the following epidemiological exposure history and clinical manifestations:

(1)Epidemiology:

1)Having a history of travel or residence in Wuhan and its surrounding areas, or other communities with case reports within 14 days before the disease onset;

2)Having a contact history with patients(a positive result of nucleic acid test of 2019-nCoV)within 14 days before the disease onset;

3)Having a contact history with patients with fever or respiratory symptoms from Wuhan and its surrounding areas, or the communities with case reports within 14 days before the disease onset;

4)Clustering occurrence.

(2)Clinical Manifestations

1)Fever and/or respiratory symptoms;

2)In the early stage, a normal or decrease of total white blood cells count and a decrease of lymphocytes count can be found.

Regardless of epidemiological exposure histories, patients can be diagnosed as suspected cases as long as they satisfy the two clinical manifestations.

2.2.2 Clinically Diagnosed Cases

The suspected cases with imaging features of pneumonia.

2.2.3 Confirmed Cases

The clinical diagnosis cases or suspected cases with one of the following etiological evidences can be diagnosed as confirmed cases:

(1)A positive result of the nucleic acid of 2019-nCoV by real-time fluorescence RT-PCR in respiratory tract specimens or blood specimens;

(2)The virus gene sequence of respiratory tract specimens or blood specimens is highly homologous to the known 2019-nCoV.

2.2.4 Asymptomatic Carriers

Asymptomatic carriers who present with no clinical symptom but with a positive result of the pathogens tests of 2019-nCoV in respiratory tract specimens and so on, found mainly through the investigation of cluster outbreak and tracking of infectious source.

2.2.5 Cluster Outbreak

A cluster outbreak means that more than two confirmed cases or asymptomatic carriers are found within 14 days in a small area(such as a family, a building site, a work unit, etc.), and there is a possibility of humanto-human transmission caused by close contact or by exposure to infectious source together.

3 Contents

3.1 Cases Detection

3.1.1 All types and levels of medical institutions should raise awareness of the diagnosis and reporting of COVID-19 cases during the monitoring and routine diagnosis and treatment. For cases with unexplained fever, cough or breathless, etc., the following information should be collected: whether the case traveled or lived in Wuhan and surrounding areas, or communities reported confirmed cases, within 14 days before disease onset; whether the case has any contact with patients with fever or respiratory symptoms in areas or communities mentioned above; whether clustered onset is observed;and whether the case has contacted with any COVID-19 case.

3.1.2 Relevant primary organizations should organize sample test performed by professional institutions to screen high risk people who have a travel or residence history in Wuhan and surrounding areas, or other case-reported communities within the past 14 days, and have respiratory symptoms, fever, chills, fatigue, diarrhea, conjunctival congestion, etc.

3.2 Cases Report

Detected suspected cases, clinically diagnosed cases(only in Hubei Province), confirmed cases, and asymptomatic carriers of 2019-nCoV should be immediately reported online by medical institutions at all types and levels within 2 hours. The CDCs should investigate and verify submitted information immediately after receiving the reports, and complete the threelevel confirmation review of the report information through the direct online reporting system within 2 hours. For other organizations without this system, cases should be reported to county(district)level CDCs and send infectious disease report cards out within 2 hours and local CDCs are required to report the case online immediately and correct case follow-up information.

Online report procedures are as follows: select “COVID-19” as the disease type, and select “suspected cases”, “clinical diagnosis cases”(only in Hubei Province), “confirmed cases”, and “positive test” in the “case classification” to report. “Clinical severity” of suspected cases, clinically diagnosed cases(only in Hubei Province), and confirmed cases should be classified as “Mild”, “Ordinary”, “Severe”, or “Critical” according to Diagnosis and Treatment Plan of Corona Virus Disease 2019(Tentative Fifth Edition). A positive test refers to a person with asymptomatic infection and these cases should be selected as “asymptomatic carriers” in “clinical severity”.

Reported “suspected cases” and “clinical diagnosed cases”(only in Hubei Province)should be promptly modified to “confirmed cases” or eliminated in time based on laboratory examination results. Reported“asymptomatic carriers” with clinical manifestations should be corrected in time as “confirmed case” if clinical manifestations are found. For all cases,corrections for “clinical severity” should be made in time based on disease progression and the most severe state should be regarded as final state.

3.3 Detection and Report of the Incident

Local CDC should conduct online report through the Emergency Public Reporting System(EPRS)within 2 hours once the first COVID-19 case is confirmed, or a clustered outbreak is confirmed, according to National Emergency Plan for Public Health Emergencies and the National Working Standards for the Management of Related Information Reports on Public Health Emergencies (Tentative Edition). The severity level could be “unclassified” at the beginning and is modified by health administrative department based on results of incidence investigation, risk assessment and further development,and the beginning, development, and ending of the case should also be reported online in time.

3.4 Epidemiological Investigation

The county(district)level CDC should complete the case investigation within 24 hours and conduct close contacts registration when received reports about COVID-19 suspected cases, clinical diagnosis cases(only in Hubei province), confirmed cases and asymptomatic carriers according to the Epidemiological Investigation Plan of Corona Virus Disease 2019 Cases(Fourth Edition)and Management Plan for Close Contacts of Corona Virus Disease 2019 Cases(Fourth Edition). The case investigation information of confirmed cases and asymptomatic carriers should be reported through NNDRS in time.

All county(district)level CDCs should report the epidemiological investigation and analysis report to the local health administration departments and senior CDCs in time.

3.5 Specimens Collection and Laboratory Examination

Clinical specimens of each case collected by medical institutions should be sent to local designated laboratory, or CDC, or third-party testing institution for pathogen test as soon as possible.

Clinical specimens include patients’ upper respiratory tract specimens(such as throat swabs, nasal swabs, etc.), lower respiratory tract specimens(such as respiratory tract aspirates, bronchial lavage fluid, alveolar lavage fluid, deep sputum, etc.), eye conjunctiva swabs, stool specimens,anticoagulant and serum specimens, etc. Efforts should be made to collect respiratory specimens(especially lower respiratory tract specimens)at early stage of disease onset, and serum at acute phase within 7 days of disease onset, as well as serum of recovery period at 3 to 4 weeks after disease onset.

Specific requirements for clinical specimen collection and laboratory examination could be referred to the Technical Guidance on Laboratory Testing of Corona Virus Disease 2019 (Fourth Edition).

Specimen collection, transportation, storage and test are temporarily managed as the Class B high pathogenicity pathogenic microorganisms, and should comply with the Biosafety Management Regulation of Laboratories for Micro-organisms, Regulations on the Management and Transportation of Human Infectious High Pathogenicity Pathogenic Microorganism Strains or Samples(No.45,issued by the Former Ministry of Health) and other relevant requirements.

3.6 Review Requirements of Laboratory Examination Results for Clustered Cases

The original specimens of more than 5 clustered cases in each region should be sent to the China CDC for review and confirmation.

Appendix 2 Epidemiological Investigation Plan of Corona Virus Disease 2019 Cases

(Fourth Edition)

This plan is formulated to better understand the epidemiological information of incidence, exposure and contact history of the COVID-19 cases, to screen close contacts, and to prevent epidemic spread.

1 Aims

1.1 To investigate the incidence and treatment, clinical characteristics,risk factors and exposure history of each case;

1.2 To identify and manage close contacts.

2 Population

COVID-19 suspected cases, clinical diagnosis cases(only in Hubei province), confirmed cases, asymptomatic carriers and cluster outbreak.

3 Contents and Methods

3.1 Case investigation

The county(district)level CDC should complete the epidemiology investigation within 24 hours since receiving relevant reports. The investigation can be carried out by consulting references, collecting related information with cases, insiders and appointed doctors. The case should be investigated first, and then the doctors, family members and insiders, if possible.

Investigation contents for suspected cases and clinically diagnosed cases(Hubei province only)are: basic information and close contacts. Only the first two parts of the questionnaire should be filled in(Box 1.1).

Investigation contents for confirmed cases and asymptomatic carriers are: basic information, disease onset and treatment, risk factors and exposure history, laboratory examinations results, close contacts, and other information showed in the questionnaire(see Box 1.1).

Judgement and management of close contacts is carried out according to the Management Plan for Close Contacts of Corona Virus Disease 2019 Cases(Fourth Edition).

3.2 Cluster Outbreak Investigation

Investigation should be imposed by the county(district)level CDC once cluster outbreak is confirmed according to the NNDRS and case survey results, as well as the definition in the Surveillance Plan of Corona Virus Disease 2019 Cases(Fourth Edition).Except for the source of infection and close contacts of all cases, the survey should also focus on investigating the epidemiological relationships among cases, analyzing the transmission chain,and filling in the basic information of the incident, beginning, development and final report in accordance with the requirements of the National Working Standards for the Management of Related Information Reports on Public Health Emergencies(Tentative Edition).

4 Organization and Implementation

Based on the principle of “localized management”, the health administration departments at county(city, district)levels should organize disease prevention and control agencies to conduct epidemiological investigations for COVID-19 cases. An investigation team should be set up promptly, and each organization should clarify the purpose of the investigation, as well asspecify team composition and targeted responsibilities according to the investigation plan. Investigators should ensure personal safety during the investigation. The municipal, provincial and national CDCs should dispatch professionals to reach to the site as the epidemic handling needed, and conduct epidemiological investigation with the investigation team jointly.

5 Information Report and Analysis

The county(district)level CDC should report the case questionnaire or investigation results through the NNDRS within 2 hours, and submit the epidemiological investigation and analysis report to local health administration department and the senior CDC after completing case investigation for confirmed cases, or asymptomatic carriers or cluster outbreak.

Investigation Questionnaire for Corona Virus Disease 2019 Cases

(Fourth Edition)

Questionnaire No. _______ ID Card No._______

I Basic Information

The following items are same with the pandemic infectious disease report card, and the relevant information is directly transferred to case investigation information system and does not need to be re-entered.If any information is inconsistent, please check and modify it in the pandemic infectious disease report card.

1. Name:____; If it’s a child, the name of guardian:____

2. Gender: □Male □Female.

3. Date of birth:____(year/month/day), Age(if the date of birth is unknown, full age:____years/____months old)

4. Current address:____Province____City____County(District)____Township(Street)____Village(Community)

5. Contact phone number:____________

6. Date of onset:____________

7. Date of diagnosis:____________

8. Type of diagnosis: □ Suspected case □ Clinically diagnosed case(Hubei Province only)□Confirmed case □Positive test(asymptomatic carrier)

9. Clinical severity: □ Asymptomatic infection □ Mild □ Normal □ Severe□Critical

II Close Contacts

III Disease Onset and Treatment

10. Symptoms and signs:

□Fever: highest body temperature________°C

□Shiver □Dry cough □Expectoration □Stuffy nose □Runny nose

□Sore throat □Headache □Fatigue □Muscle soreness □Joint soreness

□Shortness of breath □Dyspnea □Chest tightness □Chest pain

□Conjunctival congestion □Nausea □Vomiting □Diarrhea

□Abdominal pain □Other______

11. Complications:

□Yes □No

If yes, please select(multiple choices): □ Meningitis □ Encephalitis□ Bacteremia/Sepsis □ Myocarditis □ Acute lung injury/ARDS □ Acute kidney injury □ Epilepsy □ Secondary bacterial pneumonia □ Other______

12. Routine blood examination:

□ No □Yes

If yes, examination time:________(year/month/day)(if those who have examined for many times fill in the results of the first examination)

Examination result: WBC(white blood cell count)________×109/L; L(lymphocyte count)________×109/L; L(lymphocyte percentage)________%; N(neutrophil percentage)________%

13. Imaging features of pneumonia by chest X-ray examination:

□Unexamined □No□Yes

If yes, examination time:________(year/month/day)

14. Imaging features of pneumonia by chest CT examination :

□Unexamined □No□Yes

If yes, examination time:________(year/month/day)

15. Seeing a doctor after disease onset: □No □Yes

If yes, the date of the first visit:________(year/month/day), the name of the hospital:_____

16. Quarantine: □No □Yes

If yes, quarantine start date:________(year/month/day)

17. Being hospitalized:

□No □Yes

If yes, date of admission:________(year/month/day)

18. Accepting ICU treatment:

□No □Yes

If yes, entry date:____(year/month/day)

IV Risk Factors and Exposure History

19. Whether the patient belongs to the following specific occupational groups:

□ Medical staff □ Other staff in the hospital □ Pathogen microbiology testers □ Wild animal contact related personnel □ Poultry, livestock farmers □Other_____

20. Whether the patient is pregnant:

□Yes □No

21. Medical history(multiple choices):

□No □Hypertension □Diabetes

□ Cardiovascular and cerebrovascular diseases □ Lung diseases(such as asthma, cor pulmonale, pulmonary fibrosis, silicosis, etc.)□ Chronic kidney disease □ Chronic liver disease

□ Immunodeficiency diseases □ Other_____

Exposure history within 14 days before disease onset or nucleic acid tests is positive:

22. Whether there is a travel or residence history of Wuhan and its surrounding areas, or other communities with case reports:

□Travel history □Residence history □No

23. Whether contacted with people with fever or respiratory symptoms from Wuhan and its surrounding areas, or from communities with case reports:

□Yes □No

24. Whether contacted with anyone who has a history of travel or residence in Wuhan and its surrounding areas, or other communities with case reports:

□Yes □No

25. Whether there is a history of contact with confirmed cases or asymptomatic carriers:

□Yes □No

26. Does the patient have clustering disease in the same family, work office,nursery or school or other collective places?

□Yes □No □Don’t know

27. Whether there is a history of medical treatment in a medical institution:

□Yes □No

28. Is there any farmer’s market around the place of residence(village /residential building):

□Yes, about_____ meters from home □No □Don’t know

29. Has ever been to a farmers’ market:

□Yes □No □Don’t know

If yes, the case in a farmers’ market is: □ Market employee □ Supplier/importer □ Consumer □ Others_____(including food delivery, finding people, passing, etc.)

V Laboratory Examination

30. Sample collection and detection of 2019-nCoV(multiple choices):

Box 1.1 Investigation Questionnaire for Corona Virus Disease 2019 Cases

Appendix 3 Management Plan for Close Contacts of Corona Virus Disease 2019 Cases

(Fourth Edition)

Based on current understanding of the 2019-nCoV infection, the incubation period for COVID-19 is up to about 14 days, and cases are transmitted from human to human, this plan is formulated to define and manage close contacts of the COVID-19 cases and effectively control the epidemic spread.

1 Criteria

Close contacts refer to people who have contacted with suspected or clinically diagnosed cases(only in Hubei Province), or confirmed cases after disease onset, or positive asymptomatic carriers, and satisfy one of the following situations, but have not taken effective protection:

1.1 Living, studying or working together, or having close contact in other situations, such as working at close range or sharing same classrooms or living in same house;

1.2 Medical staff who provide diagnosis and treatment services to patients, or family members who provide care or visit, or anyone who have similar close contact with cases, such as visiting or staying in a confined environment, or other patients and their accompanying staff in the same ward;

1.3 People who are in same transportation and have close contact with cases, including carers or accompanying persons(family members,colleagues, friends, etc.)on the same transportation, or other passengers or flight attendants who may have close contact with cases or asymptomatic carriers after investigation. See Box 1.2 for methods of defining close contacts on different vehicles.

1.4 People who are considered satisfying close contact criteria after field investigation and evaluation.

People who have been identified as close contacts are required to fill in the Registration Form for Close Contacts of Corona Virus Disease 2019 Cases (Table 1.1).

2 Management Requirements

2.1 Contact Management

Medical observations should be organized by health administrative departments of each region with relevant departments together. Contacts that refuse to comply should be took compulsory isolation measures by local public security organizations.

2.1.1 The reasons, deadlines, legal basis, precautions, and diseaserelated knowledge of medical observations, as well as the names and contact information of institutions or medical staff that are responsible for medical observations, should be informed to close contacts in writing or orally before implementation.

2.1.2 Centralized isolation medical observation should be adopted for close contacts, or implement home-based isolation medical observation for regions that centralized isolation is inaccessible, and pay attention to strengthen the management of home observation objects. Medical observation period is 14 days since the last unprotected contact with COVID-19 cases or asymptomatic carriers. Close contacts of confirmed cases or asymptomatic carriers should continue to be observed until the expiry even if they get negative result of the nucleic acid test during the period.Close contacts of suspected case can be released from medical observation if the suspected case is excluded.

2.1.3 Close contacts who receive centralized or home-based isolation for medical observation should live alone and minimize contact with coresidents. Cleaning and disinfection of medical observation sites should be done to avoid cross-infection. For details, please refer to Technical Plan for Disinfection in Specific Places (Second Edition). People are not allowed to go out during the observation period, and should acquire permission form medical observation management staff if people have to go out, and they need to wear disposable surgical masks and avoid going to crowded places.

2.1.4 Health risks should be notified to general contacts(e.g. living,studying or working together; taking same airplane, train or ship)other than close contacts. They should be instructed to go to hospital promptly and inform the recent history of activities if they show respiratory symptoms such as fever, cough, and diarrhea and conjunctival congestion.

2.2 Measures during Medical Observation Period

2.2.1 Following measures should be taken during medical observation period:

(1)Medical staff of designated medical and health institutions is responsible for medical observation of the close contacts of COVID-19 cases.The observation measures include: measuring body temperatures of close contacts(twice a day, in the morning and evening, respectively), inquiring about their health status, filling in the medical observation form for close contacts, filling in Medical Observation Registration Form for Close Contacts of Corona Virus Disease 2019 Cases (Table 1.2), and giving necessary medical help and advice. The daily summary of medical observation of close contacts can be reported based on Daily Statistics Form of Medical Observation for Close Contacts of Corona Virus Disease 2019 Cases (Table 1.3)and Daily Statistics Summary Form of Medical Observation for Close Contacts of Corona Virus Disease 2019 Case (Table 1.4).

(2)Medical staff carrying out medical observation should keep effective personal protection. Refer to Guidance of Individual Protection in Specific Groups(Second Edition)on protective measures.

2.2.2 During medical observation period, medical staff should immediately send the close contacts showing suspicious symptoms to designated medical institutions for clinically diagnosis and treatment,collect specimens for laboratory examinations and screening, and report to local health administrative department. The suspicious symptoms include fever, shiver, dry cough, expectoration, stuffy nose, runny nose,sore throat, headache, fatigue, muscular soreness, arthralgia, polypnea,dyspnea, chest tightness, conjunctival congestion, nausea, vomiting,diarrhea and abdominal pain. If the close contacts are diagnosed as suspected cases, clinically diagnosed cases(Hubei only)or confirmed cases,people intimately contact with them are recommended to be kept under medical observation.

2.2.3 Close contacts free of symptoms above should be removed from medical observation after the end of the period.

2.3 Centralized Medical Observation Sites

2.3.1 The requirements of the centralized medical observation sites selection and internal facilities are as follows:

(1)Centralized medical observation sites should be selected in the downwind, relatively remote, and with convenient transportation, relatively far away from densely populated areas(in principle, greater than 500 meters), and relatively independent. Centralized quarantine should not be set up in medical institutions.

(2)The interior of the centralized medical observation site should be divided into living areas, material supply areas, and wards, etc. according to needs, and the zone mark should be clear. The site should be equipped with infrastructures to ensure people’s normal life and available ventilation conditions to meet the implementation of daily disinfection measures.

(3)There should be independent septic tanks and the sewage should be disinfected before entering the municipal drainage pipe network. Pouring chlorine-containing disinfectants regularly to ensure the total residual chlorine is 10 mg/L after sterilization for 1.5 hours. The disinfected sewage should meet the Water Pollutant Discharge Standards for Medical Institutions(GB18466-2005). Collect the excrement in a special container and discharge it after disinfection if independent septic tanks are not available. Refer to the General Principles of Disinfection of Epidemic Sources (GB19193-2015)for disinfection.

2.3.2 Centralized medical observation sites should provide single rooms.Biosamples should be collected and tested in time once relative symptoms like fever, cough and other respiratory infections, diarrhea, conjunctival congestion and other symptoms appear.

Guidelines for Defining Close Contacts in Vehicles

1 Aircraft

1.1 In general, all passengers in the same row and within three rows in front and back of the case in the cabin of a civil aircraft, as well as flight attendants who provided cabin services in the above areas are close contacts. Other passengers on the same flight are general contacts.

1.2 All persons in the cabin of a civil aircraft without equipment of highefficiency particulate filtering device.

1.3 Other persons known to have close contact with the case.

2 Train

2.1 In a fully enclosed train, all passengers and train crews from the case’s compartment(hard seat/hard sleeper/soft sleeper).

2.2 In a train that is not fully enclosed, passengers who were in the same soft-bedroom as the case, or in the same hard-seat(hard sleeper)compartment and in the same area or adjacent areas with the case,and train staff who served the area.

2.3 Other persons known to have close contact with the case.

3 Car

3.1 When traveling in a fully enclosed bus, all persons in the same car as the case.

3.2 When traveling in an ordinary ventilated passenger car, passengers who sit within the three rows in front and back of the case, and drivers.

3.3 Other persons known to have close contact with the case.

4 Ship

Everyone in the same cabin with the patient and crews who served the cabin.

If the case has severe symptoms such as high fever, sneezing,coughing, and vomiting during the contact period, all persons who contacted with the case should be treated as close contacts regardless of the length of time.

Box 1.2 Guidelines for Defining Close Contacts on Different Vehicles

1. Contact frequency: i)Often ii)Usually iii)Occasionally

2. Contact location: i)Home ii)Medical institution iii)Office space iv)Entertainment place v)Others(please indicate in the form)

3. Types of contact: i)Eat together ii)Live together iii)Roommate iv)Same bed v)Staying/working together vi)Diagnosing and treating, nursing vii)Same ward viii)Entertainment ix)Others(please indicate in the form)

Note:

1. This form is intended for performing medical observations of COVID-19 cases and close contacts of asymptomatic carriers.

2. In “Clinical Manifestations”, fill in the measured temperature in “Body Temperature”, and if “Cough” appears, click“√”, otherwise click “×”. Fill in the corresponding code for other manifestations: i)Chills ii)Sputum iii)Stuffy nose iv)Runny nose v)Sore throat vi)Headache vii)Fatigue viii)Muscle aches ix)Joint pains x)Shortness of breath xi)Chest tightness xii)Conjunctival congestion xiii)Nausea xiv)Vomiting xv)Diarrhea xvi)Abdominal pain

A ffiliation:______Filler:______Date:______

Note:

1. This form is applicable to medical workers for reporting medical observation of COVID-19 close contacts.

2. Abnormal clinical manifestations include: fever, cough, shortness of breath and other symptoms.

3. The cumulative numbers in the table refer to the aggregated data since the medical observations of close contacts starts.

A ffiliation:______(Medical and Health Institutions)Filler:______ Date:______

Note:

1. This form can be used for statistical summary of municipal and district CDCs.

2. Abnormal clinical manifestations include: fever, cough, shortness of breath and other symptoms.

3. The cumulative numbers in the table refer to the aggregated data since the medical observations of close contacts starts.

Affiliation:______Filler:______Date:______

Appendix 4 Technical Guidelines for Laboratory Examination of Corona Virus Disease 2019

(Fourth Edition)

This guideline is specially developed in order to guide disease control departments at all levels and other relevant institutions to carry out laboratory examination of COVID-19 and nucleic acid detection methods that are easy to use.

1 Specimens Collection

1.1 Collection object

Suspected cases, clinically diagnosed cases(only in Hubei Province)and clustered cases of COVID-19, others who need differential diagnosis of COVID-19, or other environmental or biological materials that require further screen and test(e.g. traceability analysis).

1.2 Specimen Collection Requirements

1.2.1 People engaged in the specimens collection of COVID-19 cases should receive biosafety training(qualified training)and possess corresponding experimental skills. Required personal protective equipment(PPE)for sampling people include: N95 or better protective masks, goggles,one-piece protective clothing, double-layer latex gloves, waterproof boots cover, and the outer latex gloves should be replaced in time if they contact with patients’ blood, body fluids, secretions or excreta.

1.2.2 The specimens of hospitalized cases should be collected by medical staff of the hospital.

1.2.3 The specimens of close contacts should be collected by the local designated disease control and medical institutions.

1.2.4 Multiple sampling combined with the course of the disease can be implemented according to the needs of laboratory examination.

1.3 Specimen Collection Types

Respiratory specimens(including upper and lower respiratory tract specimens)of each case must be collected during acute period; lower respiratory tract specimens(such as bronchi or alveolar lavage fluid, etc.)should be collected as a priority among severe cases; eye conjunctival swabs should be collected in cases with ocular infection symptoms; and stool specimens should be taken in cases with diarrhea symptoms. Specimens can be collected according to clinical manifestations and the interval of sampling time.

Other research materials are collected according to design requirements.

Types of specimens are as follows:

1.3.1 Upper respiratory tract specimens include: pharynx swabs, nasal swabs, nasopharyngeal extracts and so on.

1.3.2 Lower respiratory tract specimens include: deep cough sputum,respiratory tract extract, bronchial lavage fluid, alveolar lavage fluid, lung tissue biopsy specimens.

1.3.3 Blood samples: try to collect 5 mL fasting blood with vacuum blood tube containing EDTA anticoagulant during acute phase of anticoagulation(within 7 days after disease onset).

1.3.4 Serum samples: try to collect two serum samples in acute phase and convalescent stage. The first serum should be collected as soon as possible(better within 7 days since disease onset), and the second serum should be collected between the 3rd to 4th week after disease onset. A total of 5 mL serum should be collected and vacuum blood vessel without anticoagulant is suggested be used. Serum samples are mainly used for the antibody detection, which is used to confirm infectious status. Serum samples are not tested for nucleic acid.

1.3.5 Eye conjunctival specimens: eye conjunctival wipe specimens should be collected among cases with ocular infection symptoms.

1.3.6 Stool specimens: stool specimens should be collected among all patients with diarrhea symptoms.

1.4 Specimen Collection Methods

1.4.1 Pharynx swabs: wipe bilateral pharyngeal tonsils and posterior pharyngeal walls with two plastic rod swabs with polypropylene fiber heads at the same time. Immerse the swabs head in a tube containing 3 mL virus preservation solution(also with isotonic salt solution, tissue culture medium or phosphate buffer). Discard the tail and tighten the tube cover.

1.4.2 Nasal swabs: gently insert a plastic rod swab of polypropylene fiber head into the inner nasal and palatal region of the nasal canal, stay for a while and slowly rotate and exit. The plastic rod swab of another polypropylene fiber head is taken to collect the other nostril in the same way.The two swabs are immersed in the same tube containing 3 mL sampling solution, and the tail is discarded and the tube cover is tightened.

1.4.3 Nasopharyngeal or respiratory extracts: use a collector connected with a negative pressure pump to extract mucus from the nasopharynx or respiratory secretions from trachea. Insert the collector head into the nasal cavity or trachea, turn on the negative pressure, rotate the collector head and slowly exit, collect the extracted mucus, and rinse the collector once with 3 mL sampling solution(the collector can be replaced by connecting the child catheter with 50 mL syringe).

1.4.4 Deep cough sputum: the patient is required to cough deeply and the sputum should be collected in a 50 mL screw plastic tube containing 3 mL sampling liquid.

1.4.5 Bronchial lavage fluid: insert the collector head from the nostril or trachea socket into trachea(about 30 cm depth), inject 5 mL saline, turn on the negative pressure, rotate the collector head and slowly exit. Collect the extracted mucus and rinse the collector with sampling solution once(the child catheter can also be connected to the 50 mL syringe to replace the collector).

1.4.6 Alveolar lavage fluid: insert fiber-bronchoscope into the branch of the middle lobe of the right lung or the lingual segment of the left lung through the mouth or nose and the pharynx after local anesthesia, the top of fiber-bronchoscope is inserted into the opening of the bronchial branch,and 30–50 mL sterilized saline is added slowly per time through the trachea biopsy hole, the total amount of saline is 100–250 mL and should not exceed 300 mL.

1.4.7 Blood samples: it is suggested that 5 mL blood sample should be collected by vacuum blood tubes containing EDTA anticoagulant. Keep the sample at a room temperature for 30 minutes and centrifuge it at 1,500–2,000 rpm for 10 minutes. Plasma and blood cells are collected respectively in sterile screw plastic tubes.

1.4.8 Serum samples: 5 mL blood samples are collected by vacuum negative pressure blood collection and should be kept at a room temperature for 30 minutes, centrifuged at 1,500–2,000 rpm for 10 minutes, and collected in sterile screw plastic tubes.

1.4.9 Fecal specimens: the fecal specimens should be collected for 3–5 mL among people with diarrhea symptoms in the early stage of the disease,

1.4.10 Eye conjunctival swabs: wipe the surface of the eye conjunctiva with a swab and put the swab head into sampling tube, abandon swab tail,and suspend tube cover.

Other materials: collect according to design requirements.

1.5 Specimen Packaging

The specimens are collected and assembled in the biosafety cabinet of the Class B biosafety laboratory.

1.5.1 Specimen should be placed in a suitable-sized sample collection tube with a screw cover and a gasket and resistant to freezing. Tighten it.The sample number, type, name and sampling date should be indicated outside the container.

1.5.2 Seal the sealed specimens in a plastic bags of the suitable size and hold one specimen in each bag. The sample packing requirements should satisfy the corresponding standards of the Technical Rules for Safe Aviation Transport of Dangerous Goods.

1.5.3 If external specimen transportation is involved, three-layer packaging shall be carried out according to specimen type as Class A or B infectious substances.

1.6 Specimen Preservation

Samples used for virus isolation and nucleic acid test should be tested as soon as possible, and the samples that will be tested within 24 hours can be stored at 4 °C; those cannot be tested within 24 hours should be stored at–70 °C or below(if not available, specimens should be temporarily stored in the refrigerator at –20 °C). The serum can be stored for 3 days at 4 °C and longer at –20 °C or lower. A special storehouse or counter should be set up to restore specimens separately. Repeated freezing and thawing should be avoided during specimen transportation.

1.7 Clinical Specimens Examination

Clinical specimens should be sent to laboratories as soon as possible after collection. Refrigerated storage methods like using dry ice are recommended if long-distance transportation is needed.

1.7.1 Clinical Specimens Submission

Clinical specimens from cluster outbreak cases of all provinces and areas should be submitted to National Institute for Viral Disease Control and Prevention of China CDC for reexamination, attached with the clinical specimen submission form(Table 1.5).

1.7.2 Pathogen and Clinical Specimen Transportation

(1)Domestic Transportation

The 2019-nCoV strains and other potentially infectious biological materials are considered as dangerous goods and classified into Class A,with a corresponding UN number of UN2814, of which packages should comply with the standard packaging requirements(PI602)of ICAO Technical Instructions for the Safe Aviation Transport of Dangerous Goods (Doc9284).Environmental specimens are classified into Class B, with a corresponding UN number of UN3373, of which packages should comply with the standard packaging requirements(PI650)of ICAO Technical Instructions for the Safe Aviation Transport of Dangerous Goods (Doc9284). Requirements for packages transported by other vehicles can refer to the above standards.

The application of transportation permit for 2019-nCoV strains or specimens should follow requirements of Regulations on the Management and Transportation of Human Infectious High Pathogenicity Pathogenic Microorganism Strains or Samples (No.45, issued by the Former Ministry of Health).

(2)International Transportation

The 2019-nCoV strains and specimens transported internationally should be packaged according to the standard packaging requirements above.The application of transportation permit should follow the requirements of Regulations for Health Inspection and Quarantine of Special Entry Exit Goods and other relevant national and international requirements.

(3)Pathogen and Clinical Specimen Management

The 2019-nCoV strains and specimens should be managed by specialassigned personnel. Sources, types, quantity and serial numbers of the strains should be accurately recorded. Efficient measures should be taken to ensure the security of the strains and specimens and to prevent the occurrence of uselessness, malicious use, stolen, robbed, or leakage events,etc.

2 Laboratory Examination of 2019-nCoV

Conventional detection of 2019-nCoV infection is real-time fluorescence RT-PCR. All examinations for 2019-nCoV must be performed by staff with relevant technical and safe knowledges in laboratories with proper conditions. Nucleic acid detection methods in this guideline mainly target the open reading frame 1ab(ORF1ab)and nucleocapsid protein(N)of 2019-nCoV genome.

To confirm a positive case in the laboratory, the following conditions should be satisfied:

The specific real-time fluorescence RT-PCR test results are positive at both two targets of COVID-19(ORF1ab, N)in a same specimen and resampling and retesting are required if only one positive result is observed.

2019-nCoV infection cannot be excluded by negative results, and factors that may cause false negatives should be excluded, including: poor sample quality, such as respiratory tract samples from oropharynx; too early or too late collection of samples; failure to properly store, transport and process samples; other technological problems such as virus mutation, PCR suppression, etc.

3 2019-nCoV Nucleic Acid Detected by Real-time Fluorescence RT-PCR

3.1 Aims

To standardize the working procedure of real-time fluorescent RTPCR detection for 2019-nCoV nucleic acid, and to ensure the accuracy and reliability of the experimental results.

3.2 Application scope

Applied to real-time fluorescent RT-PCR test for 2019-nCoV nucleic acid.

3.3 Responsibility

Tester: responsible for testing samples in accordance with this test guideline.

Reviewer: responsible for reviewing whether the test operation is standard and whether the test result is accurate.

Head of the department: responsible for reviewing the department comprehensive management and test report.

3.4 Sample Reception and Preparation

Check the name, gender, age, ID and test items of the sample; any abnormal sample should be marked; samples should be stored in a –70 °C refrigerator before test.

3.5 Test Items

3.5.1 Test for 2019-nCoV nucleic acid(real-time fluorescent RT-PCR)

Primers and probes targeting the ORF1ab and N gene region of 2019-nCoV are recommended.

Target one(ORF1ab):

Forward primer(F): CCCTGTGGGTTTTACACTTAA

Reverse primer(R): ACGATTGTGCATCAGCTGA

Fluorescent probe(P): 5’-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGGBHQ1-3’

Target two(N):

Forward primer(F): GGGGAACTTCTCCTGCTAGAAT

Reverse primer(R): CAGACATTTTGCTCTCAAGCTG

Fluorescent probe(P): 5’-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3’

Reaction system and reaction conditions of nucleic acid extraction and real-time fluorescence RT-PCR refer to kit instructions.

3.5.2 Result Judgement

Negative: no Ct value or Ct ≥40.

Positive: Ct <37 could be reported to be positive.

Gray area: Ct values between 37 and 40 and retest is recommended. If the repeated Ct value <40, and the amplification curve shows obvious peaks,the sample should be judged as positive, otherwise negative.

Note: if commercial kit is used, the instructions provided by the manufacturer shall prevail.

4 Requirements for Pathogen Biosafety Experiments

According to the 2019-nCoV biological characteristics, epidemiological characteristics, clinical data and other information that are available currently, 2019-nCoV is temporarily managed as Class B pathogenic microorganisms, and the specific requirements are as follows:

4.1 Virus Cultivation

Virus cultivation refers to operations such as isolation, culture, titration,neutralization test, purification of live virus and its protein, freeze-drying of virus and recombination experiment of producing living virus. The above operations shall be conducted in the biosafety cabinet of the biosafety level 3(BSL-3)laboratory. When extracting nucleic acid from viral culture,the addition of lysis agent or inactivating agent must be operated under protective condition and in laboratories with biosafety level equal to virus culture required. After the addition of lysis agent or inactivating agent, the viral culture can be operated referring to the protective level of uncultured infectious materials. The laboratory should apply for approval by the National Health Commission of the People’s Republic of China before carrying out relevant activities.

4.2 Animal Infection Experiment

Animal infection experiment refers to the experimental operations such as infecting animals with live virus, sampling from infected animals,handling and testing infectious samples, special examination of infected animals, and disposing the excreta of infected animals. These operations should be conducted in a biosafety cabinet of the BSL-3 laboratory. The laboratory should apply for approval by the National Health Commission of the People’s Republic of China before carrying out relevant activities.

4.3 Operations on Uncultured Infectious Materials

Operations on uncultured infectious materials refer to operating, such as virus antigen detection, serological detection, nucleic acid extraction,biochemical analysis, and inactivating clinical samples, on uncultured infectious materials before reliable inactivation. These operations should be conducted in the BSL-2 laboratory, and adopt personal protective condition as the BSL-3 laboratory.

4.4 Operations to Inactivate Material

Nucleic acid testing, antigen testing, serological testing, biochemical analysis and other operations of infectious materials or live viruses that are inactivated by reliable methods should be carried out in the BSL-2 laboratory. Other operations that involve inactive pathogenic viruses, such as molecular cloning, can be carried out in BSL-1 laboratory.

*“Gene Sequence Homology” is optional, and note the specific target gene sequence/whole genome sequence, and its homology with 2019-nCoV.

§Fill in YES or NO.

Appendix 5 Inh4idual Protection Guidelines for Specific Populations

(Second Edition)

This guide is used in the prevention and control of the COVID-19 for the staff conducting epidemiological investigations, working in isolating wards and medical observation sites, and the professionals participating in transfer of cases and infected persons, cadaver handling, environmental cleaning and disinfection, specimen collection and laboratories work, etc.

1 Inh4idual Protective Equipment and Usage

Individual protective equipment should be used by all persons who contact with or may contact with COVID-19 cases and asymptomatic carriers’ contaminants(such as blood or body fluid secretions, vomit, feces,etc.)and contaminated articles or environmental surfaces, including:

1.1 Gloves

According to the work content, wear disposable rubber or nitrile gloves when entering the contaminated area or performing diagnosis and treatment operations. Disinfect in time, change gloves, and carry out hand hygiene when contacting with different patients or when gloves are broken.

1.2 Medical Protective Masks

People entering the contaminated area or performing diagnosis and treatment operations should wear medical protective masks or powered air filter respirators. Test the air tightness first when wearing the mask and ensure the medical protective mask is removed lastly when wearing multiple protective equipment.

1.3 Protective Face Screen or Goggles

Wear protective face screens or goggles if the eyes, conjunctiva and face are at risk of being contaminated by blood, body fluids, secretions, feces and aerosols when entering the contaminated areas or performing diagnosis and treatment operations. Disinfect and dry reusable goggles in time for standby after use.

1.4 Protective Suits

Change personal clothing to overalls(surgical brush or disposable clothing, etc.)and protective clothes when entering contaminated areas or performing medical operations.

2 Hand Hygiene

Use quick-drying hand disinfectant when there is no visible contaminant, and use hand sanitizer to wash hands under water and followed by quick-drying hand sanitizer when visible contaminants are present.

Hand hygiene should be strictly complied in daily work, especially before wearing gloves and personal protective equipment, before aseptic operations, before contacting with patients’ blood, body fluids and their contaminated items or contaminated environmental surfaces, and removing personal protective equipment.

3 Inh4idual Protection of Specific Populations

3.1 Epidemiological Investigators

Wear disposable work caps, medical-surgical masks, work clothes, and disposable gloves, and keep a distance of more than 1 meter from the subject when investigating close contacts.

Wear work clothes, disposable work caps, disposable gloves, protective clothing, KN95/N95 and above particulate protective masks or medical protection face masks, protective face screens or goggles, work shoes or rubber boots, waterproof boot covers, etc., when investigating suspected cases, clinically diagnosed cases(only in Hubei Province), confirmed cases and asymptomatic carriers. Investigating these cases by telephone or video is also recommended.

3.2 Staff of Isolation Ward or Medical Observation Site

Wear work clothes, disposable work caps, disposable gloves, protective clothing, medical protective masks or powered air filter respirators,protective face screens or goggles, work shoes or rubber boots, waterproof boot covers, etc.

3.3 Workers for Transfer of Cases and Asymptomatic Carriers

Work clothes, disposable work cap, disposable gloves, protective clothing, medical protective mask or power supply filter respirator,protective face screen or goggles, work shoes or rubber boots, waterproof boot covers, etc. are recommended.

3.4 Cadaver Handlers

Work clothes, disposable work caps, disposable gloves, and longsleeved thick rubber gloves, protective clothing, KN95/N95 or better particulate protective masks, or medical protective masks, or powered air filter respirators, protective face screens, work shoes or rubber boots,waterproof boot covers, waterproof apron or waterproof isolation clothing are recommended.

3.5 Staff for Environmental Cleaning and Disinfection

Work clothes, disposable work caps, disposable gloves, and long-sleeved thick rubber gloves, protective clothing, KN95/N95 and above particulate protective masks or medical protective masks or powered air filter respirators, protective face screens, work shoes or rubber boots, waterproof boot covers, waterproof apron, or waterproof gowns are recommended.Select a dust-toxin combination filter box or canister according to disinfectant types, and impose chemical protection such as disinfectant when using powered air-supply filter respirators.

3.6 Staff for Specimen Collection

Work clothes, disposable work caps, double gloves, protective clothing,KN95/N95 or better particulate protective masks, or medical protective masks, or powered air filter respirators, protective face screens, work shoes,or rubber boots, and waterproof boot covers are recommended. Wear a waterproof apron or waterproof gown if necessary.

3.7 Laboratory Staff

Wear at least work clothes, disposable work caps, double gloves,protective clothing, KN95/N95 or better particulate protective masks, or medical protective masks, or powered air filter respirators, protective face screens or goggles, work shoes or rubber boots, Waterproof boot cover. Wear a waterproof apron or waterproof gown if necessary.

4 Precautions for Protective Equipment Remove

4.1 Try not to touch the contaminated surface when disassembling.

4.2 The protective blindfold, long tube rubber shoes, and other nondisposable items taken off should be put directly into the container containing disinfectant soak; the remaining disposable items should be placed in yellow clinical waste collection bags for centralized disposal.

4.3 Hand disinfection should be carried out at every step of unloading protective equipment, as well as taking off all protective equipment.

Appendix 6 Technical Plan for Disinfection in Specific Places

(Second Edition)

1 Disinfection Principles

1.1 Determination of Scope and Objects

Determine the scope, objects and time limit of on-site disinfection according to the results of epidemiological investigation. Places where confirmed cases and asymptomatic carriers have lived, such as residences,isolation wards of medical institutions and transportation tools, etc. should be disinfected at any time. All places should be implemented terminal disinfection after discharge or death of cases, or after nucleic acid test changes to negative in asymptomatic carriers.

1.2 Method Options

Medical institutions should try to choose disposable medical supplies,pressure steam sterilization should be the first choice for disinfecting nondisposable medical supplies, and non-heat resistant items can be disinfected or sterilized by chemical disinfectant or low temperature sterilization equipment. The surface of environment objects can be wiped, sprayed or soaked with chlorine-containing disinfectants, chlorine dioxide and other disinfectants. Hands and skin are suggested to be wiped by effective hand skin disinfectant or quick-drying hand disinfectant such as iodophor,chlorine-containing disinfectant and hydrogen peroxide. Indoor air can be disinfected by peroxyacetic acid, chlorine dioxide, hydrogen peroxide and other disinfectants by spraying. All disinfectant products used should meet the management requirements of the national health departments.

2 Disinfection Measures

2.1 Concurrent Disinfection

Concurrent disinfection refers to the timely disinfection of objects and places polluted by confirmed cases and asymptomatic carriers. Places where patients have lived, such as residences, isolation wards of medical institutions, medical observation places, transportation tools, etc. should be applied concurrent disinfection, as well as pollutants excreted by patients and relative contaminated items. Refer to terminal disinfection for sterilization methods. Spraying disinfection is not recommended in the presence of people. Places where patients are isolated can take ventilation measures(including natural ventilation and mechanical ventilation)to keep indoor air flowing. Make sure ventilate twice or three times per day for at least 30 minutes each time.

Medical institutions with sufficient conditions should place patients in the negative pressure isolation wards, isolate suspected cases in individual single rooms. Confirmed cases can be placed in the same room. Non negative pressure isolation wards should be well ventilated, and disinfect air by ventilating(including natural ventilation and mechanical ventilation)and circulating air disinfector. Air can also be disinfected by ultraviolet under unmanned conditions, the exposure time can be appropriately extended to more than 1 hour if disinfected by ultraviolet. Medical staff and accompanying staff should wash and disinfect hands after diagnosis,treatment and nursing work.

2.2 Terminal Disinfection

Terminal disinfection refers to the thorough disinfection after the source of infection leaves. Air and various items should be ensured free of pathogens after terminal disinfection. The objects of terminal disinfection include pollutants(blood, secretions, vomit, excreta, etc.)discharged from confirmed cases and asymptomatic carriers, and potentially contaminated items and places. Large area disinfection of outdoor environment(including air)is not necessary. Places where cases and asymptomatic carriers stayed for a short time without obvious pollutants do not need terminal disinfection.

2.2.1 Residence of Patient

Terminal disinfection should be performed after the patient is hospitalized or died, and a negative results of nucleic acid test of asymptomatic carriers; including floor and wall of rooms, tables, surfaces of furniture including tables and chairs, door handles, patient’s tableware(drinkware), clothes, bedding and other daily necessities, toys, bathroom including toilets, etc.

2.2.2 Transportation Tools

Transportation tools should be performed terminal disinfection after cases and asymptomatic carriers leaving. Objects of disinfection include:surfaces of cabin inner wall, seats, sleepers, table and etc; tableware and drinkware; bedding and other textiles used; excreta, vomit and contaminated items and areas; toilets of trains and airplanes, etc.

2.2.3 Medical Institutions

Terminal disinfection should be completed in fever clinics and infection clinics after daily work, and isolation wards should be disinfected after the patient is hospitalized or dies, or asymptomatic carriers show negative results of nucleic acid test. Floor and walls; surfaces of tables, chairs, bedside tables, bed frames, etc.; patient’s clothes, bedding and other daily necessities and related medical supplies; indoor air, etc. are suggested for terminal disinfection.

2.2.4 Terminal Disinfection Procedure

Terminal disinfection procedure complies with Appendix A of General Principles for Disinfection of Epidemic Focus (GB19193-2015). On-site disinfection staff should take personal protection when preparing and using chemical disinfectants.

3 Disinfection Methods for Common Contaminated Objects

3.1 Indoor Air

Terminal disinfection of indoor air in living place such as residences and isolation wards of medical institutions can refer to Hospital Air Purification Management Code (WS/T 368-2012). Disinfectants such as peroxyacetic acid,chlorine dioxide and hydrogen peroxide can be selected for disinfection by ultralow volume spray under unmanned conditions.

3.2 Pollutants(Blood, Secretions, Vomit, Excreta of Patients)

A small amount of pollutants can be carefully removed by dipping 5,000–10,000 mg/L of chlorine-containing disinfectant(or disinfection wipes/dry wipes that can reach high level of disinfection)with disposable absorbent materials(such as gauze, rags, etc.)

A large amount of pollutants should be completely covered with disinfectant powder or bleach powder containing water-absorbing ingredients, or fully covered with disposable water-absorbing materials and poured with a sufficient amount of 5,000–10,000 mg/L chlorine-containing disinfectant. Keep for more than 30 minutes(or use disinfection dry towel that can reach high level of disinfection), and carefully remove it. Avoid contacting with pollutants during the removal process, and the pollutants removed should be centrally disposed as medical wastes. The excreta,secretions, vomit, etc. of patients should be collected in special containers,and disinfected with 20,000 mg/L chlorine-containing disinfectant at a ratio of 1:2 in feces and medicine for 2 hours.

The surfaces of the polluted environmental objects should be disinfected after removing the pollutants. Containers containing pollutants can be soaked in disinfectant solution containing 5,000 mg/L effective chlorine for 30 minutes, and then cleaned.

3.3 Floor and Wall

Visible pollutants should be completely removed before disinfection while invisible pollutants can be wiped or sprayed with 1,000 mg/L chlorinecontaining disinfectant or 500 mg/L chlorine dioxide disinfectant. Floor disinfection should be completed by spraying from outside to inside with a spray volume of 100-300 mL/m2 firstly, and spraying from inside to outside again after indoor disinfection. Disinfection time should not be less than 30 minutes.

3.4 Surfaces of Objects

Visible contaminants on surfaces of treatment facilities and equipment,as well as bed fences, nightstand, furniture, doorknobs and other household items, should be completely removed before disinfection. For invisible pollutants, spraying, wiping or soaking with 1,000 mg/L chlorine-containing disinfectant or 500 mg/L chlorine dioxide disinfectant for 30 minutes are recommended.

3.5 Clothing, Bedding and Other Textiles

Aerosol generation should be avoided during item collection, and it is recommended to perform incineration as medical wastes. Items with invisible pollutants can be sterilized for reuse by circulating steam or boiling for 30 minutes, or soaking with 500 mg/L chlorine-containing disinfectant for 30 minutes and then cleaning as usual, or loading directly into the washing machine with water soluble packaging bags and washing disinfection for 30 minutes, and maintaining the effective chlorine content at 500 mg/L. The ethylene oxide can be used to disinfect expensive clothing.

3.6 Hand Hygiene

All personnel involved in field work should strengthen hand hygiene.Effective alcohol-based quick drying hand disinfectants can be used, as well as chlorine or hydrogen peroxide-based hand disinfectants under special conditions. Hand sanitizer should be used to wash hands under running water when there are visible pollutants, and then disinfect.

3.7 Skin and Mucosa

Skin contaminated by pollutants should be wiped with 0.5% iodophor or hydrogen peroxide disinfectant with a disposable absorbent material for more than 3 minutes after removing pollutants, and then cleaned with water.Mucosa should be rinsed with plenty of normal saline or 0.05% iodophor.

3.8 Tableware

After removing food residue, tableware should be boiled and sterilized for 30 minutes, or soaked in 500 mg/L chlorine-containing disinfectant with effective chlorine for 30 minutes, then be rinsed with water.

3.9 Transportation

The pollution situation should be evaluated first. Visible pollutants in trains, cars and ships should be completely removed by using disposable absorbent material with 5,000–10,000 mg/L chlorine-containing disinfectant(or can achieve high levels of disinfection wet towel/dry towel), then be sprayed or wiped with 1,000 mg/L chlorine-containing disinfectant or 500 mg/L of chlorine dioxide disinfectant disinfection for 30 minutes. When disinfecting aircraft cabins, the types and doses of disinfectants should be in accordance with the relevant provisions of Civil Aviation Administration of China(CAAC). Fabrics, cushions, pillows and sheets are recommended to be treated as clinical waste.

3.10 Household Garbage from Patients

The patients’ household garbage should be treated as clinical waste.

3.11 Clinical Waste

The disposal of medical waste should comply with the requirements of the Regulations on the Management of Medical Wastes and the Measures for the Management of Medical Waste in Medical and Health Institutions, and should be handled in accordance with the conventional disposal process after packaging with double-layer yellow collection bags.

3.12 Corpse Disposal

Minimizing movement and transportation of dead patient, which should be handled timely by trained staff under strict protection. Use 3,000–5,000 mg/L chlorine-containing disinfectant or 0.5% peroxyacetic acid cotton ball or gauze to fill all open channels or wounds, such as mouth, nose,ear, anus, tracheostomy, etc. Wrap the corpse in a double layer cloth soaked with disinfectant, put it into a double layer body bag, and sent it directly to designated place by a special vehicle of the civil affairs department for cremation as soon as possible.

3.13 Matters Need Attention

Timely disinfection work should comply with the guidance of the local disease control and prevention agencies, and implemented by relevant organizations or by local disease control and prevention agencies. The concurrent disinfection and terminal disinfection of the medical institutions should be arranged by medical institutions, and the technical guidance should be provided by CDC. Non-professional personnel should receive professional training from local disease prevention and control institutions before carrying out disinfection work, take proper disinfection methods and pay attention to personal protection.

4 Evaluation of Disinfection Effect

Relevant laboratory personnel qualified for inspection and testing should evaluate disinfection effect of object surfaces, air and hands if necessary.

4.1 Surfaces

Object surfaces are sampled before and after disinfection according to Hygienic Standard for Disinfection in Hospitals (GB15982-2012), Appendix A,and the sampling solution after disinfection is the corresponding neutralizer.

Disinfection effect is generally evaluated based on natural bacteria,or indicate bacteria which have equal or greater resistance than existed pathogens according to actual situation. Qualified disinfection can be judged by ≥90% inactive rate of natural bacteria on the disinfection object after disinfection if taking natural bacteria as the indicator, or ≥99.9% for indicator bacteria.

4.2 Indoor Air

Air sampling are taken before and after disinfection according to the Appendix A of Hygienic Standard for Disinfection in Hospitals(GB15982-2012)and the sampling plate should contain corresponding neutralizer after disinfection. Disinfection can be judged as qualified if the extinction rate of natural bacteria in the air is ≥90%.

4.3 Staff’s Hands

Hand sampling is taken before and after disinfection according to the Appendix A of Hygienic Standard for Disinfection in Hospitals (GB15982-2012),and the sampling solution after disinfection is the corresponding neutralizer.Disinfection can be judged as qualified if the inactive rate of natural bacteria on hands before and after disinfection is ≥90%.

4.4 Hospital Sewage Disinfection Effect

The evaluation is conducted in accordance with the relevant regulations of Water Pollutant Discharge Standards for Medical Institutions (GB18466).In areas with sustained community transmission, such as Wuhan, Hubei province, local health protection programs should be formulated for temporary special places such as centralized treatment points and centralized isolation sites.